Polymerase Chain Reaction

Wayne's WordIndexNoteworthy PlantsTriviaLemnaceaeBiology 101BotanySearch

Biology 100 Laboratory Manual Exercise # 3 (Continued)

Polymerase Chain Reaction (PCR)

Replicating Millions of Copies From a Single Gene

Table Of Contents:

  1. PCR & Phylogenetic Trees (Cladograms)
  2. Genes Used To Compare Genera & Species
     A. Cladogram of the Duckweed Family
     B. Duckweeds Are Now Placed In Arum Family
     C. Common Terms Used In Cladistics Analyses
     D. Phylogeny Of Major Gymnosperm Families
     E. Brodiaea Now Placed In The Themidaceae
     F. Changes To Monocot Families & Telomeres
     G. Major Changes To The Snapdragon Family    
     H. Changes To Devil's Claws (Martyniaceae)
     I. New World Origin Of The European Potato
  3. DNA Patterns From Gel Electrophoresis
  4. Automatic Sequencing Of DNA Bases
  5. Amplification Of DNA (Genes) Using PCR
  6. Extraction Of DNA From Tissue Sample
        The PCR Technique Step By Step:
  7. DNA Ladder "Unzips" Into Two Strands
  8. Primer Attaches To One End Of DNA Strand
  9. Telomeres & End Replication Problem
  10. DNA Strands Replicate Into Double Strands
  11. Two DNA Ladders Unzip Into Four Strands
  12. Animation Of Exponential Gene Replication
  13. Using Lice DNA To Date The Use Of Clothing


1. PCR & Phylogenetic Trees (Cladograms)

In the mid-1980s, Kary Mullis devised a method of replicating genes called "PCR" (polymerase chain reaction). A DNA sequence less than one part in a million of the total sample can be cloned. In fact, a single gene can be amplified into millions of duplicate copies. In order to determine the exact DNA sequence of a gene or section of DNA, it is necessary to have an adequate sample of the particular gene to work with. This is why PCR is so valuable because it allows a researcher to replicate a gene into a workable amount. Many fields of biology utilize DNA sequencing, including plant and animal taxonomy. By comparing the DNA sequences of genes, it is possible to create phylogenetic trees called cladograms which show the degree of relatedness between species. Using thousands of data characteristics, including the DNA sequences of genes, cladograms can be generated by computers.


2. Using DNA Sequences To Compare Genera & Species

With an unlimited number of bases, each DNA sequence shown above has
1,099,511,600,000 (or more than one trillion) possible arrangements.

Depending on the desired phylogenetic level, conserved and non-conserved genes are used. Highly conserved genes code for structural products, regulatory proteins, and transfer RNAs. Their sequences are very stable because changes in the DNA (mutations) are usually detrimental. Genes that are not highly conserved are subject to mutations. In DNA comparisons between species, non-coding spacer genes are sometimes used. Since spacer genes are not under selection, they may contain different DNA sequences useful in comparing species. For example, phylogenetic studies and cladograms for the duckweed family (see below) were based on sequences of the trnL-trnF intergenic spacer region of the chloroplast genome. This spacer region is non-coding DNA between the trnL and trnF loci.

Different genes within the nucleus and cytoplasmic organelles (chloroplast and mitochondria) can be used to construct phylogenetic trees called cladograms. One gene in the nucleolus codes for the smaller subunit of the ribosome. The gene is called SSU rDNA or small subunit ribosomal DNA. Base sequences from this gene are sometimes used to compare taxa at the species level. Chloroplast DNA, including the protein-coding rbcL gene, is often used at the family level to show the relationships between genera and species within the family. Introns are also used to construct family trees. Introns are sections of messenger RNA that are removed prior to translation at the ribosome. The following cladogram shows all the five genera and 38 species within the duckweed family (Lemnaceae). It was generated from DNA sequences of rbcL genes from all known members of the the family using the computer program PAUP:


2A. Cladogram Of The Duckweed Family (Lemnaceae)

Most botanists consider the Lemnaceae to be closely related to the arum family (Araceae), and comparative chloroplast DNA studies have confirmed this taxonomic affinity (Duvall, et al. Annals of the Missouri Botanical Garden Vol. 80, 1993). In fact, several authorities have proposed some drastic and significant changes in the classification of many traditional angiosperm families, including the placement of all duckweeds in the Araceae rather than the Lemnaceae. [See: Angiosperm Phylogeny Group. 1998. "An Ordinal Classification For The Families Of Flowering Plants." Annals of the Missouri Botanical Garden 85: 531-553; Judd, W.S., C.S. Campbell, E.A. Kellogg, P.F. Stevens, and M.J. Donoghue. 2008. Plant Systematics: A Phylogenetic Approach. 3rd Edition. Sinauer Associates, Inc., Sunderland, MA.] Some of these proposed changes are summarized in an article by E. Dean in Fremontia 30 (2): 3-12, 2003. If accepted by the botanical community, the incorporation of these changes into botany textbooks, floras, checklists and herbarium collections will be a formidable task.

Computer-generated evolutionary trees or cladograms have been used to show the taxonomic relationships of duckweed species within the family. The cladograms are based on thousands of data characters, including morphology, anatomy, flavonoids, allozymes, and DNA sequences from chloroplast genes and introns. The branch (clade) length and position in the tree correspond to the number of character differences between taxa. The characters are numerically weighted according to their evolutionary importance. For example, a root would have a higher value than a papule. Cladograms are generated multiple times, and they don't always come out the same. The term "bootstrapping" refers to a cladogram or phylogenetic tree that comes out the same way out of a total number of times. For example, one thousand cladogram "trees" are generated randomly and the same pattern comes out 900 times. This cladogram would have a bootstrap value of 90 percent. The term "jackknifing" is similar to bootstrapping. Rather than resampling DNA data randomly for cladogram trees like the bootstrap does, the jackknife takes the entire sample except for 1 value, and then calculates the test statistic of interest. It repeats the process, each time leaving out a different value, and each time recalculating the test statistic. Like bootstrapping it can generate phylogenetic patterns with a percentage value. Some taxononomists prefer bootstrap values while others use jackknife values. The following cladogram shows all the five genera and 38 species within the duckweed family (Lemnaceae). It was generated from DNA sequences of rbcL genes from all known members of the the family using the computer program PAUP:

A cladogram of the duckweed family based on the chloroplast gene rbcL. Five genera and 38 species are shown. According to the cladogram, the ancestral genus is Spirodela and the genusWolffia is placed farthest away because it has the fewest shared characters with Spirodela. Spirodela, Landoltia and Lemna are more closely related, while Wolffia and Wolffiella have more characters in common. With the exception of one new genus Landoltia and a few changes within sections of the family, most of the results are consistent with previous studies based solely on morphological characteristics made by meticulous botanists. Cladogram modified from Les, D.H., Crawford, D.J., Landolt, E., Gabel, J.D. and R.T. Kimball. 2002. "Phylogeny and Systematics of Lemnaceae, the Duckweed Family." Systematic Botany 27 (2): 221-240.

Like fruit flies of zoology laboratories, duckweeds have been studied extensively in the fields of cytology, genetics and physiology. These minute flowering plants can easily be grown in small containers of water or cultured aseptically (axenically) in nutrient agar. Duckweeds are ideal research subjects for laboratories because they take up very little space and reproduce asexually at an astonishing rate.

  Complete List Of 38 Species In Duckweed Family  
Axenic Culture Of Duckweeds In Nutrient Agar
Home Page About North American Duckweeds


2B. Duckweeds Now Placed In The Arum Family (Araceae):

Phylogenetic trees (cladograms) showing relationship of Pistia (Araceae) to the duckweed family (Lemnaceae).


Most authors now agree that duckweeds are an early offshoot from the aroid linkage (Araceae) and are represented in the fossil record since the late Cretaceous by the genus Limnobiophyllum. Although the latter genus has affinities with water lettuce (Pistia), the oldest fossils attributable to Pistia date back only to late Oligocene/early Miocene. Because of its morphological similarity, the aroid Pistia stratioides has been considered a close relative (cousin) of the Lemnaceae. Morphological analysis of the fossil paleocene aroid Limnobiophyllum scutatum by Stockey et al. (1997) indicates that Lemnaceae plus Pistia form a monophyletic group within the Araceae; however, more recent DNA cladistical analyses have different results. Phylogenetic studies by G.W. Rothwell et al. (2004) and L.I. Cabrera et al. (2008) indicate that Pistia and Lemnaceae belong to distantly related clades, suggesting at least two independent origins of the floating aquatic growth form within the arum family (Araceae).

Left Image: Titan arum (Amorphophallus titanum) a member of the arum family (Araceae). At its maximum development, a spadix over 8 feet tall (2.4 m) emerges from a huge vase-shaped, pleated spathe 12 feet (4 m) in circumference.

  Titan Arum: The Stinkiest Arum  
Water lettuce (Pistia stratiotes): An aquatic member of the arum family (Araceae) with characteristics similar to the duckweed genus Spirodela. For decades, Pistia was thought to be a possible ancester to the duckweeds; however, phylogenetic studies using chloroplast DNA indicate that Pistia cannot be considered a morphological intermediate between duckweeds and other arums. Note the small white spathe (red arrow) surrounding the anthers at the apex of a reduced spadix.

  Cladogram From Cabrera et al. (2008)  
Pistia cannot be considered a morphological intermediate between duckweeds and other arums. Maintaining Lemnaceae and Araceae as distinct families would make the arum family paraphyletic, with a common ancestor but not all of its decendants (i.e. duckweeds are excluded). Their cladograms are based on sequences of the trnL-trnF intergenic spacer region of the chloroplast genome. This spacer region is non-coding DNA between the trnL and trnF loci. Because it is non-coding, it is not under selection (not highly conserved), compared with highly conserved genes that code for structural products, regulatory proteins, or transfer RNAs. Highly conserved genes remain relatively unchanged. Changes (mutations) in these genes are usually unfavorable.
  • Cabrera, L.I., Salazar, G.A., Chase, M.W., Mayo, S.J., Bogner, J., and P. Dávila. 2008. "Phylogenetic Relationships of Aroids and Duckweeds (Araceae) Inferred From Coding and Noncoding Plastid DNA." American Journal of Botany 95 (9): 1153-1165.

  • Rothwell, G.W., Van Atta, M.R., Ballard Jr., H.E. and R.A. Stockey. 2004. "Molecular Phylogenetic Relationships among Lemnaceae and Araceae Using the Chloroplast trnL-trnF Intergenic Spacer." Molecular Phylogenetics and Evolution 30: 378-385.

  • Stockey, R. A., Hoffman, G.L., and G. W. Rothwell. 1997. "The Fossil Monocot Limnobiophyllum scutatum: Resolving the Phylogeny of Lemnaceae." American Journal of Botany 84 (3): 355-368.
  Complete List Of All Species Of Lemnaceae  
PCR & Cladogram Of The Lemnaceae
Stinking Arums That Attract Flies


2C. Terms Used For Taxonomic Groupings: Monophyletic, Paraphyletic and Polyphyletic

Cladogram: A diagram or phylogenetic tree that shows ancestral monophyletic relationships between species. A group of species connected by a single branch or clade have a common ancestor and are termed monophyletic. Two sister clades with the same common ancestor are also termed monophyletic. Cladograms are generated by computers using a program such as PAUP (available for PCs, Mac and Linux). Morphological data was originally used to create cladograms, but most modern taxonomists now use DNA sequence data.

Monophyletic: A taxonomic group that represents a single branch (clade) in a cladogram, and having a common ancestor. For example, all birds and reptiles are thought to have descended from a single common ancestor and are monophyletic. Humans (Homo) and chimpanzees (Pan) are also monophyletic. Each of the three genera (Araucaria, Agathis and Wollemia) in the plant family Araucariaceae are monophyletc, although Wollemia is the most primitive. The araucaria and podocarpus families (Podocarpaceae), which have their greatest diversity in the southern hemisphere, are also monophyletic and occur on sister clades. These two families have a common ancestor that lived in the southern supercontinent called Gondwanaland.

Paraphyletic: If the grouping includes a common ancestor plus some, but not all, decendants it is paraphyletic. Modern reptiles is a grouping that contains a common ancestor, but does not contain all descendants of that ancestor (i.e. birds are excluded).

Polyphyletic: If the grouping includes two or more separate monophyletic or paraphyletic groups, each with a separate common ancestor, it is polyphyletic. The common ancestor of all members is not itself a member of the group. A grouping of warm-blooded animals would include birds and mammals and is called polyphyletic because the members of this grouping do not include the most recent common ancestor.

Conserved Genes: Depending on the desired phylogenetic level, conserved and non-conserved genes are used. Highly conserved genes code for structural products, regulatory proteins, and transfer RNAs. Their sequences are very stable because changes in the DNA (mutations) are usually detrimental. Genes that are not highly conserved are subject to mutations. In DNA comparisons between species, non-coding spacer genes are sometimes used. Since spacer genes are not under selection, they may contain different DNA sequences useful in comparing species. For example, phylogenetic studies and cladograms for the duckweed family were based on sequences of the trnL-trnF intergenic spacer region of the chloroplast genome. This spacer region is non-coding DNA between the trnL and trnF loci. Different genes within the nucleus and cytoplasmic organelles (chloroplast and mitochondria) can be used to construct phylogenetic trees called cladograms. One gene in the nucleolus codes for the smaller subunit of the ribosome. The gene is called SSU rDNA or small subunit ribosomal DNA. Base sequences from this gene are sometimes used to compare taxa at the species level. Chloroplast DNA, including the protein-coding rbcL gene, is often used at the family level to show the relationships between genera and species within the family. Introns are also used to construct family trees. Introns are sections of messenger RNA that are removed prior to translation at the ribosome. Parsimony: The least complex explanation for an observation. In other words, do not generate a hypothesis any more complex than is demanded by the data. In systematics, maximum parsimony is a cladistic "optimality criterion." Under maximum parsimony, the preferred phylogenetic tree is the tree that requires the smallest number of evolutionary changes. The principle of parsimony is stated in Occam's Razor (Ockham's Razor). It is attributed to the 14th century English logician, theologian and Fransiscan friar William of Ochham. The popular computer program used to generate phylogenetic trees from DNA sequence data is called PAUP: Phylogenetic Analysis Using Parsimony.

PAUP File Formats:
freqpars
GCG
Hennig86
MEGA
NBRF & PIR
Phylip 3.x
Simple Text   (See example to right:)
Tab Delimited Text
Simple Text

  species1   GCAGTCTGAACGCACGAAGCCGACTGGTGACGAACGCACC
  species2   GTAATTACCGCTCTTCCCCTGCAAAGTGGCAGAAGTGACA
  species3   TTAGTGTCAGCATGCAACACAACGCGGATCGTAATACAAC
  species4   TTGTGTCGAGTGGCTTTATACAGGTGTGTGTACTCCTGAA
  species5   AAAGGGCGTTATTACGGTAGGGGCTGAATCGAGTTGTAGC
  species6   GGGGTACAGCGCCATAGCGCAAAAAGGAAGTGGCAGTAAA

Boot Strap Value: This definition is greatly oversimplified. Cladograms are computer-generated multiple times, and they don't always come out the same. The term "bootstrapping" refers to a cladogram or specifically a clade (branch of a phylogenetic tree) that comes out the same way out of a total number of times. For example, if one thousand clades are generated randomly and the same pattern comes out 900 times, this clade would have a bootstrap value of 90 percent. The original clade consisting of Agapanthus (lily of the Nile) and Amaryllidaceae (amaryllis family) had only a 63 percent bootstrap value. It was rejected by the Angiosperm Phylogeny Group (APG) and replaced by a different clade with a higher bootstrap value. The genus Agapanthus is now placed in its own family the Agapanthaceae and shares a common (monophyletic) ancestry with the Amaryllidaceae and Alliaceae (onion family). The latter family was once placed in the Amaryllidaceae.

Comparison Of Boot Strap Value Used In Cladograms With The Generation Of Crossword Puzzles: I.e. Using Same Down & Across Choices.

  1. Computer generates same crossword puzzle 100 times, but grid patterns are not all the same.

  2. Out of total of 100, the left pattern comes up 85 times.

  3. The Bootstrap Value would be 85/100 or 85 percent.

Restriction Enzyme: An enzyme that cuts double-stranded or single-stranded DNA at specific recognition nucleotide sequences known as restriction sites. These enzymes occur naturally in bacteria plasmid DNA and are thought to have evolved as a defence mechanism against viruses. Many are commercially available for DNA research laboratories, particularly for the isolation of specific genes or intergenic spacers used in DNA comparisons between different species and genera.

Indel: A mutation that includes an insertion or deletion resulting in a gain or loss of nucleotides. A microindel is a gain or loss of 1 to 50 nucleotides. In coding regions of the genome, unless the length of an indel is a multiple of three nucleotides, they produce a frame-shift mutation. Indels can be contrasted with a point mutation: An indel inserts or deletes nucleotides from a sequence; a point mutation is a substitution that replaces one of the nucleotides.

  Chemical Compounds Part I: The Structure & Function Of DNA  


2D. Phylogeny Of Gymnosperm Families

A modern representation of the phylogeny of gymnosperms based on chloroplast DNA. Dichotomous (paired) sister branches (clades) with a common ancestor are said to be monophyletic and are more closely related. For example, the conifer division Pinophyta (Coniferophyta) and ginkgo division (Ginkgophyta) have a common ancestor in the cycad division (Cycadophyta). The pine family (Pinaceae) and a sister branch leading to six additional families have a common ancestor within the division Pinophyta. In other words, the seven major families of cone-bearing trees and shrubs all evolved from the division Pinophyta. The araucaria and podocarpus families (Araucariaceae and Podocarpaceae), which have their greatest diversity in the southern hemisphere, are monophyletic and occur side-by-side on sister clades. Chart by E.M. Armstrong (2008).

Update On The Taxonomy Of Cypresses (Cupressus)

Just when I think I have a handle on the taxonomy of cypresses (Cupressaceae), new research emerges from the amazing field of DNA phylogeny and cladistic analysis. In October 1999, a new cypress species was discovered in northern Vietnam. It was named Xanthocyparis vietamensis. [The name Cupressus vietnamensis also appears in some garden references.] Surprisingly enough, its closest relative was found to be the Alaska cedar (Chamaecyparis nootkatensis syn. Cupressus nootkatensis), separated by thousands of miles and on opposite sides of the Pacific Ocean. The two species were so similar that the authors (Farjon et al 2002), working in Kew, England, combined them generically, and the Alaska cedar became Xanthocyparis nootkatensis. Port Orford cedar (Chamaecyparis lawsoniana) resembles other North American and Asian species of Chamaecyparis in both morphology and DNA, so its scientific name remains unchanged.

The Alaska cedar is the only Chamaecyparis species that forms spontaneous, fertile hybrids with Cupressus species when these are grown together in botanical gardens. Evidence from DNA and morphology indicates that it and the Vietnam cypress are closely related phylogenetically to the New World species of Cupressus (Little et al, 2004). The Old World species of Cupressus, however, are a separate evolutionay line, as is the large genus Juniperus. True Chamaecyparis species are only distantly related to the cluster genera that includes Old World Cupressus, Juniperus, Xanthocyparis, and New World Cupressus. In a comprehensive study, Little, D.P. (2006) proved that the Alaska Cedar and its Vietnam relative should be placed in the same genus as the New World Cupressus, but that the correct generic name for this group is Callitropsis. His study incorporated 88 morphological and wood-chemistry characteristics in 56 species of Cupressaceae, combined with sequence analysis of three chloroplast genes and two nuclear genes. The name Cupressus technically only applies to the Old World species in this genus. It turns out that Callitropsis nootkatensis was used for the Alaska cedar in 1864, long predating the name Xanthocyparis. In accordance with the Botanical Rule of Priority, the older name must be used. Therefore, Alaska cedar becomes Callitropsis nootkatensis, Vietnam cypress becomes Callitropsis vietnamensis, and the Alaska cedar-Monterey cypress hybrid becomes Callitropsis x leylandii. Damon Little (2006) also proposed that all of the New World Cupressus be placed in the genus Callitropsis. The latter genus superficially resembles the Australian genus Callitris. In the revised Jepson Manual: Vascular Plants of California, Jim Bartel has changed the genus Cupressus to Hesperocyparis (western cypress). Callitropsis may also be moved into Hesperocyparis at the 2012 Botanical Congress in Melbourne.

Based on their general morphological appearance, the New World Cupressus (Hesperocyparis) certainly resemble Old World Cupressus species; however, this similarity may be due to parallel evolution (homoplasy) in similar warm, dry climates. Just because these two groups of cypress appear similar doesn't necessarily mean that they are all closely related members of the same genus. DNA comparisons appear to reflect their true genetic affinities and differences. Groupings of species, such as Callitropsis, Chamaecyparis, Juniperus and Old World Cupressus represent separate branches (clades) in computer-generated phylogenetic trees.

Using DNA to Compare Genera & Species
Homoplasy: Parallel and Convergent Evolution
  Representatives of the Taxodium Family (Taxodiaceae)  

Barcode Chloroplast Genes: matK & rbcL.  Intergenic Spacer: trnL.  Nuclear Ribosomal DNA: nrDNA

Adams, R.P., Bartel, J.A., anf R.A. Price. 2009. "A New Genus, Hesperocyparis For The Cypresses Of
      The Western Hemisphere (Cupressaceae)." Phytologia 91 (1): 160-185.

Seed cones from cypress groves in California, Arizona and outside the U.S.

A - N: New World Cypress (Hesperocyparis)
formerly placed in the genus Cupressus
O - R: Old World Cypress (Cupressus)
Includes the Italian Cypress
S: False Cypress (Chamaecyparis)
Includes the Port Orford Cedar
T - U: Nootka Cypress (Callitropsis) Includes
Alaska Cedar; may become Hesperocyparis

A. Tecate cypress (H. forbesii), B. Sargent cypress (H. sargentii), C. Piute cypress (H. nevadensis), D. Cuyamaca cypress (H. stephensonii), E. Santa Cruz cypress (H. abramsiana, F. Monterey cypress (H. macrocarpa), G. Gowen cypress (H. goveniana), H. Mendocino cypress (H. pygmaea), I. Macnab cypress (H. macnabiana), J. Modoc cypress (H. bakeri), K. Smooth-bark Arizona cypress (H. glabra), L. Rough-bark Arizona cypress (H. arizonica), M. San Pedro Martir cypress (H. montana), N. Mexican cypress (H. lusitanica), O. Italian cypress (C. sempervirens), P. Sahara cypress (C. dupreziana), Q. Kashmir cypress (C. cashmeriana), R. Mourning cypress (C. funebris), S. Port Orford cedar (C. lawsoniana), T. Alaska cedar (C. nootkatensis), U. Leyland cypress Callitropsis x leylandii).

Note: The Port Orford cedar (S) remains in the genus Chamaecyparis, while the and Alaska cedar (T) is now placed in the genus Callitropsis, while the Leyland cypress (U) becomes Callitropsis x leylandii. Callitropsis may be rejected by 2012 Botanical Congress and possibly changed to Hesperocyparis. Groupings of species, such as Hesperocyparis (Callitropsis), Chamaecyparis, Juniperus and Old World Cupressus represent separate branches (clades) in computer-generated phylogenetic trees.

  Cupressus: Remarkable Conifers Native To California  
Selection & Genetic Drift In Cypresses (Cupressus)

Alaska cedar (Callitropsis nootkatensis) at Government Camp, Oregon.

Flattened branchlets and cypress-like seed cones of Alaska cedar (Callitropsis nootkatensis). The Alaska cedar was once considered closely related to the Port Orford cedar and both were placed in the genus Chamaecyparis. In the Jepson Manual of California Plants (1996) they were both placed in the cypress genus Cupressus. Recent DNA analysis revealed that the Alaska cedar's closest relative is the Vietnamese cypress (Callitropsis vietnamensis).

Mt. Hood, Oregon in October 2010
  Other Cedars In The Pacific Northwest  


2E. Brodiaea & Relatives Now Placed In The Themidaceae

  • Cronquist, A. 1981. An Integrated System of Classification of Flowering Plants. Columbia University Press, New York, New York, USA.

  • Dahlgren, R., Clifford, H.T., and P.F. Yeo. 1985. The Families of the Monocotyledons: Structure, Function, and Taxonomy. Springer Verlag, Berlin, Germany.

  • Niehaus, T.F. 1971. "A Biosystematic Study of the Genus Brodiaea (Amaryllidaceae)." University of California Publications in Botany 60: 1-66.

  • Pires, J. Chris and K.J. Sytsma. 2002. "A Phylogenetic Evaluation of a Biosystematic Framework: Brodiaea and Related Petaloid Monocots (Themidaceae)." American Journal of Botany 89 (8): 1342-1359.
  Cladogram From Chis Pires & Kenneth Sytsma (2002)  

Themidaceae: A. Santa Rosa basalt brodiaea (Brodiaea santarosae), a recently described species from the Santa Rosa Plateau of Riverside County. B. Ithuriel's Spear (Triteleia laxa) from Kern County. C. Golden stars (Bloomeria crocea) in San Diego County.

A New Brodiaea From The Santa Rosa Plateau:
Santa Rosa Basalt Brodiaea MADROÑO Vol. 54: 187-198 (2007)
  Santa Rosa Basalt Brodiaea FREMONTIA Vol. 37 (2): 20-27 (2009)
  


Alliaceae & Agapanthaceae (Formerly Amaryllidaceae); Hemerocallidaceae (Formerly Liliaceae)

(A) Tulbaghia violacea (society garlic) was originally placed in the amaryllis family, but DNA and chemistry data (S-containing compounds) now place it in the Alliaceae along with onions (Allium). Several oligosulfides have been identified in the Alliaceae, including methyl disulfide, dimethyl disulfide, dimethyl trisulfide, and n-propyl disulfide. When these compounds dissolve in the fluid covering the eyes they form sulfuric acid, hence the stinging eyes when slicing onions. (B) Agapanthaceae (Agapanthus), formerly in the Amaryllidaceae (amaryllis family). The original clade consisting of Agapanthus (lily of the Nile) and Amaryllidaceae had only a 63 percent bootstrap value. It was rejected by the Angiosperm Phylogeny Group (APG) and replaced by a different clade with a higher bootstrap value. Agapanthus is now placed in the Agapanthaceae and shares a common (monophyletic) ancestry with the Amaryllidaceae and Alliaceae (onion family). (C) Colorful red and yellow day lilies (Hemerocallis) were traditionally placed in the lily family (Liliaceae), but are now placed in the Hemerocallidaceae.


2F. Significant Changes To Other Monocot Families & Telomeres

Cladistic analysis of chloroplast DNA has resulted in some major changes in the phylogeny of angiosperms. According to Plant Systematics: A Phylogenetic Approach by Judd, et al. (2008), members of the Nolinaceae and Dracaenaceae are now included within the Ruscaceae. The latter family also includes Aspidistra (cast iron plant), Liriope (border grass) and Ophiopogon (mondo grass). Familiar genera such as Hyacinthus (hyacinth), Aspholelus (asphodel), Asparagus (asparagus), Allium (onion) and Iris (iris) belong to their own separate families, the Hyacinthaceae, Asphodelaceae, Asparagaceae, Alliaceae and Iridaceae. The latter family (Iridaceae) also includes the commonly cultivated Watsonia, Moraea (butterfly lily), Freesia (freesia), Sisyrinchium (blue-eyed grass), Crocus and Gladiolus. Amaryllis (naked lady) still belongs to the Amaryllidaceae and also includes many genera that were once placed in the Liliaceae, including Crinum, Hippeastrum (amaryllis), Hymenocallis (spider lily), Haemanthus (blood lily), and Narcissus (daffodil). Agapanthus (lily of-the-Nile), Hemerocallis (day lily) and Colchicum (autumn crocus) belong to their own families, the Agapanthaceae, Hemerocallidaceae and Colchicaceae. Lilium (lily), Tulipa (tulip), Calochortus (Mariposa lily) and Fritillaria (chocolate lily) are still included in the lily family (Liliaceae). Chlorogalum (soap lily) is now placed in the agave family (Agavaceae) with Agave, Yucca, Hesperocallis (desert lily) and Camassia (camas). Death camas and star lilies (Zigadenus) are now placed in the Melanthiaceae along with Veratrum (corn lily), Trillium (trillium) and Xerophyllum (bear grass) . The cormous genera Brodiaea (Brodiaea), Dichelostemma (blue dick), Bloomeria (golden stars) and Triteleia are now in the family Themidaceae. The genus Aloe, formerly of the Liliaceae, is now placed in the family Asphodelaceae, along with Kniphofia (red hot poker) and Haworthia. These significant changes in plant classification will be adopted by the new revised Jepson Flora of California.

From a purely morphological point of view, one of the most astonishing changes is the placement of members of the Nolinaceae and Dracaenaceae into the Ruscaceae. The type genus Ruscus includes a low-growing Eurasian shrub called butcher's broom (R. aculeata) that bears no resemblance to Nolina, Dracaena & Beaucarnea. See the following image:

Ruscaceae: (A) Ruscus aculeata (Butcher's broom), a dioecious, low-growing evergreen shrub native to the Azores, western Europe, through the Mediterranean region to Iran. Each minute, scalelike leaf (red arrow) has a flattened, leaflike branchlet called a cladode or cladophyll in its axil. These cladophylls function like leaves, but they are really modified stems. (B) Beaucarnea stricta (Ponytail), and (C) Dracaena draco (dragon tree). Although these three species bear no resemblance to each other, their DNA indicates that they are closely related and members of the same family.

Telomeres In The Order Asparagales

The large monocot order Asparagales that contains about 27,000 species (roughly10 percent of all angiosperms) has 6-base repeats of TTAGGG, the same sequence found in mammalian telomeres. This order includes many familiar plant families, such as orchids, iris, amaryllis, agave, hyacinth, asphodel, onion and asparagus. Since plants and mammals evolved into multicellular organisms along completely separate pathways, this appears to be yet another example of parallel evolution (homoplasy).

Telomeres and End Replication Problem
  Homoplasy: Parallel & Convergent Evolution  


2G. Significant Changes To The Snapdragon Family (Scrophulariaceae)

Plant Families in the Order Lamiales:

     Orobanchaceae
     Paulowniaceae
     Phrymaceae
     Pedaliaceae
     Martyniaceae
     Lamiaceae
     Verbenaceae
     Lentibulariaceae
     Acanthaceae
     Bignoniaceae
     Scrophulariaceae     
     Plantaginaceae
     Gesneriaceae
     Calceolariaceae
     Oleaceae

Computer generated monophyletic clades based on chloroplast DNA have resulted in drastic changes to the Scrophulariaceae. Plantago, Penstemon, Veronica, Linaria, Antirrhinum, Keckiella, & Digitalis are now placed in the Plantaginaceae. Mimulus with its thigmotrophic stigma is placed in the Phrymaceae. Traditional genera retained in the Scropulariaceae include Verbascum and Scrophularia. Other genera placed in the Scrophulariaceae include Buddleja and Myoporum. Indian paintbrush (Castilleja), Indian warrior (Pedicularis), and owl's clover (Orthocarpus) are placed in the parasitic family Orobanchaceae with the broomrapes (Orobanche). Other closely-related families representing separate clades are the Paulowniaceae, Lentibulariaceae, Acanthaceae and Bignoniaceae. Members of the Martyniaceae (Proboscidea, Martynia & Ibicella) are included in the Pedaliaceae with Uncarina, Harpagophytum & Sesamum.

Scrophulariaceae: (A) California bee plant (Scrophularia californica ssp. floribunda), (B) butterfly bush (Buddleja davidii) and (C) prostrate myoporum (Myoporum parvifolium). Significant changes have been made to the once enormous snapdragon family (Scrophulariaceae). Traditional genera retained in the Scropulariaceae include mullein (Verbascum) and figwort (Scrophularia). Buddleja (formerly of the Loganiaceae) and Myoporum (formerly of the Myoporaceae) are now placed in the Scrophulariaceae.
  Judd, W.S., Campbell, C.S., Kellogg, E.A., Stevens, P.F., and M.J. Donaghue. 2008. Plant Systematics: A Phylogenetic Approach
      (Third Edition). Sinauer Associates, Inc., Sunderland, Massachusetts. 611 p.

Orobanchaceae: Although (A) Indian paintbrush (Castilleja affinis ssp. affinis) and (B) Indian warrior (Pedicularis densiflora) were once placed in the snapdragon family (Scrophulariaceae), they are now placed in the parasitic broom-rape family (Orobanchaceae) along with (C) chaparral broom-rape (Orobanche bulbosa). The latter holoparasitic plant is attached to the roots of chamise (Adenostoma fasciculatum)--see roots of host shrub in photo. The Orobanchaceae are considered monophyletc, including the complete parasites lacking chlorophyll (holoparasites) and the hemiparasites with green leaves (Castilleja and Pedicularis). According to Judd et al. (2008), this affinity is supported by DNA cladistic analysis, hemi to holoparasitic habit, hair morphology and possibly their racemose inflorescences.
  Wayne's Word Article On Parasitic Flowering Plants  

Plantaginaceae: (A) Showy penstemon (Penstemon spectabilis var. spectabilis) and white-lined sphinx moth (Hyles lineata), (B) Chinese houses (Collinsia heterophylla), and (C) and foxglove (Digitalis purpurea). These common genera were formerly placed in the snapdragon family (Scrophulariaceae) but have now been transferred to the Plataginaceae.

  Hyles lineata & Penstemon spectabilis var. spectabilis  

Plantaginaceae: (A) Red-seeded plantain (Plantago rhodosperma) and (B) Nutall's snapdragon (Antirrhinum nuttalianum ssp. nutallianum. Many familiar genera of the Scrophulariaceae, such as snapdragons (Antirrhinum), Chinese houses (Collinsia), penstemons (Penstemon and Keckiella), toadflax (Linaria), and speedwell (Veronica) are now placed in the plantain family (Plantaginaceae). Plantain seeds (Plantago) are the source of the soluble fiber used in diet supplements such as Metamucil® and Hydrocil®.

A. Common plantain (Plantago major). B. Minute psyllium seeds seeds of the genus Plantago (including Plantago psyllium and P. ovata) are used in laxatives and soluble fiber supplements. The husk around each seed contains a water-soluble mucilaginous gum. Ground seeds (right) imbibe water and swell, forming a thick, jelly-like, mucilaginous mass of soluble fiber.

Phrymaceae: Red bush monkeyflower (Mimulus aurantiacus, formerly M. puniceus). This common shrub of coastal San Diego County was once placed in the snapdragon family (Scrophulariaceae). It is now placed in its own family, the Phrymaceae. The spreading stigma lobes are thigmotrophic and close together with the slightest touch of your finger or an incoming pollinator, such as the bill of a hummingbird. This action decreases the chance of self pollination and favors cross pollination, especially if the incoming pollinator is covered with pollen from another monkeyflower blossom. When the bill or head of the hummingbird enters the blossom and touches the stigma it immediately closes. Pollen carried by the bird is trapped within the closed stigma lobes. As the bird probes for nectar deep in the corolla it also picks up fresh pollen from the anthers. But when it leaves, there is little chance of this newly acquired pollen touching the stigma because it is already closed, thus averting any self pollination.


2H. Significant Changes To The Martyniaceae & Pedaliaceae

Pedaliaceae (Martyniaceae in Jepson Manual). Two North American species of Proboscidea. These species were formerly placed in the Martyniaceae along with Martynia and Ibicella. They are now placed in the Pedaliaceae in some references, along with sesame (Sesamum indicum), Uncarina and Harpagophytum: Left. Proboscidea louisianica ssp. louisianica is a native annual in the eastern United States and is naturalized in coastal Coalifornia, including San Diego County. The yellow lines in the corolla throat are nectar guide lines that direct pollinator bees to the nectar source. Right: Proboscidea althaeifolia is a native perennial in the Colorado Desert of the southwestern United States and Baja California. It blooms during the scorching heat of July and August, long after most other desert wildflowers have bloomed and gone to seed. It occurs sparingly in Anza-Borrego Desert State Park of San Diego County.

Large, hitchhiker seed capsules of the Pedaliaceae. From left: Ibicella lutea (formerly placed in the Martyniaceae), Harpagophytum procumbens, and Uncarina grandidieri.

  Devil's Claws: Hitchhikers On Big Animals  
The Ultimate & Most Painful Hitchhikers
Sesame: An Important Seed Plant


2I. New World Origin Of The European Potato

The common potato (Solanum tuberosum) is an autotetraploid species with a sporophyte chromosome number of 48 (4n=48). The normal sporophyte diploid number for the genus Solanum is 24. Eggplant (S. melongena) belongs to the genus Solanum and tomatoes (Lycopersicon esculentum) are closely related to the potato. Common potatoes (S. tuberosum) consist of two subspecies or groups, ssp. tuberosum ( "Chilotanum Group") and ssp. andigena ("Andigenum Group"). Older references state that potatoes taken to Europe in the sixteenth century all belonged to the andigena subspecies or "Andigenum Group" which was widely cultivated in the Andean highlands of Bolivia, Peru and northern Argentina. The origin of this tetraploid subspecies is controversial, but some authorities believe it resulted from hybridization between a diploid Andean species (S. stenotomum) and another diploid species (possibly S. sparsipilum), followed by autopolyploidy. The precise origin of the subspecies tuberosum or "Chilotanum Group" native to Chile is even more controversial, possibly derived from the subspecies andigena or the hybridization of subspecies andigena with yet another unknown Andean species. According to Mercedes Ames and David Spooner, the single Andigenum origin of the modern "European" potato (with cultivars grown worldwide) is not supported by plastid DNA studies from historical herbarium specimens. Their research points to a Chilotanum origin traced to a landrace indigenous to Chiloé, largest island in the Chiloé Archipelago off the coast of Chile. In addition, this research shows the critical importance of herbarium specimens in investigating historical origins of crop plants.

  Ghislain, M., J. Núñez, M. del Rosario Herrera, and D.M. Spooner. 2009. The Single Andigenum Origin of Neo-Tuberosum Materials is Not Supported by Microsatellite and Plastid Marker Analyses. Theoretical Applied Genetics 118: 963-969.

  Juzepczuk, S.W., and S.M. Bukasov. 1929. "A Contribution to the Question of the Origin of the Potato." TrVses Azeda Genet Selek 3: 593-611 (in Russian, English summary).

  Ames, Mercedes and David D. Spooner. 2008. "DNA From Herbarium Specimens Settles a Controversy About Origins of the European Potato." American Journal of Botany 95 (2): 252-257.


3. Gel Electrophoresis

The Human Genome Project is a worldwide endeavor to map the DNA base sequence of every gene in the human genome. As of February 2001, the total number of functional genes is considerably less than expected, about 30,000 genes per cell compared with previous estimates of 100,000 genes. It has been estimated that a human somatic cell contains about 5 billion base pairs. If the average gene contains 1500 bases, then 30,000 functional genes is only about one percent of the total DNA per cell. Although there is an estimated six feet of DNA per human cell, only a small fraction of this amount consititutes the actual protein-coding genes.

Much of the DNA of humans is referred to as "variable number tandem repeats" (VNTRs) rather than specific protein-coding genes. The greatest variation in the DNA of two individuals is not in the protein-coding genes, but in the nonprotein-coding sections of their DNA. Natural selection has resulted in some time-tested DNA sequences called genes which are identical in normal individuals. The exact number and order of amino acids in protein molecules are determined by the DNA base sequences of genes, and genetic mutations are essentially "misspelled " genes. Genetic mutations, including variations in the base sequences of vital genes, may be fatal if they fail to code for a vital enzyme. For example, the dominant gene for hemoglobin is a time-tested sequence of DNA bases that is essential for the production of this life-giving pigment. Hemoglobin is a quaternary protein composed of four polypeptides and 484 amino acids. The substitution of valine for glutamic acid (glutamate) in the beta polypeptide changes the oxygen-carrying potential of this vital blood cell pigment, and is the biochemical explanation for the genetic disease called sickle-cell anemia. Natural selection does not limit variability in nonprotein-coding sections since these regions of DNA are not involved in the survival or reproductive success of individuals. Consequently, the DNA used to show variation between individuals comes from the nonprotein-coding sections called VNTRs. DNA sections unique to each individual are separated in a process called gel electrophoresis using a gel box.

A gel box and power source used in general biology laboratories at Palomar College. DNA segments called restriction fragment length polymorphisms (RFLPs) migrate to the positive pole (red) of the gel box.

DNA is negatively charged and migrates to the positive pole of a gel box containing agarose gel. The porous gel is made from agar, a polysaccharide extract from red algae (division Rhodophyta). Precise amounts of the DNA solutions being compared (containing RFLPs) are transferred to indentations or wells in the gel using a micropipetter. Gel patterns are similar to chromatographs and the process of separating sections of DNA is called gel electrophoresis. Restriction enzymes cut DNA into sections or fragments called restriction fragment length polymorphisms (RFLPs). Restriction enzymes are analogous to molecular scissors, cutting the DNA at specific base sequences called restriction sites. These enzymes were originally discovered in bacteria, a remarkable defensive mechanism that enables bacteria to cleave invading viral DNA, thus rendering it harmless. One restriction enzyme can cut DNA into more than 700,000 pieces. For example, a specific restriction enzyme (Hind3) cuts the DNA between adenine and adenine on the base sequence A|AGCTT. One DNA strand runs in the 5' to 3' direction, while the complementary strand runs in the 3' to 5' direction. The complementery strand is also cut between adenine and adenine TTCGA|A. Another restriction enzyme (EcoR2) cuts the DNA between guanine and adenine on the base sequence G|AATTC. The complementary strand is also cut between adenine and guanine CTTAA|G. The exact base sequence and length of a DNA fragment varies with different individuals. Every person has fragments with different lengths and unique base patterns, such as AGCTT and AATTC. The following table summarizes how the restriction enzymes Hind3 and EcoR2 cut specific base sequences at specific retriction sites.

Hind3 Restriction Enzyme

5'    - AAGCTT -    3'
3'    - TTCGAA -    5'

5'    - A|AGCTT -    3'
3'    - TTCGA|A -    5'

   5'    - A           AGCTT -    3'   
3'    - TTCGA           A -    5'

EcoR2 Restriction Enzyme

5'    - GAATTC -    3'
3'    - CTTAAG -    5'

5'    - G|AATTC -    3'
3'    - CTTAA|G -    5'

   5'    - G           AATTC -    3'   
3'    - CTTAA           G -    5'

Because of different numbers of purine and pyrimidine bases, the DNA fragments (RFLPs) have different molecular weights and migrate to different positions in the gel box. The fragments are displayed as bands in the gel, similar to the separation of different molecules in chromatography. Gel electrophoresis can separate DNA molecules that differ in length by only a few nucleotides. Banding patterns can be enhanced when viewed on a light box or under ultraviolet light. They may also be photographed. The specific banding pattern of an individual depends on the precise fragments that are separated on a gel layer. Because everyone has slightly different banding patterns, gel electrophoresis is used to determine the precise DNA fingerprint of an individual. In a human DNA fingerprint, thousands of bands from the evidence (crime scene) and suspect are carefully compared in order to show a percent similarity. DNA fragments (RFLPs) can also be anayzed from plants, algae and fungi. In order to run a sufficient quantity of fragments to produce a visible banding pattern, the DNA is amplified using the PCR technique (polymerase chain reaction) described below.

Gel electrophoresis comparing DNA banding from a lichen Cladonia cristatella (lane L) with its symbiotic components, the photobiont alga Trebouxia erici (lane A) and the mycobiont fungus (lane F) which is also named Cladonia cristatella. Molecular weights of the different DNA fragments are shown in the far left column (S). The autotrophic alga is photosynthetic and provides carbohydrate nutrition for the heterotrophic fungus. The lichen DNA (lane L) shows some banding that is different from the patterns of its two symbionts. In true synergistic fashion, the lichen is truly more than the sum of its parts. [Gels courtesy of J.L. Platt, CSUSM, San Marcos, California.]

British soldiers (Cladonia cristatella), a soil lichen with upright podetia bearing bright red apothecia at the tips. At the bottom of the centrifuge tube (left), the fungal component of this lichen (also named C. cristatella) has grown into a white, amorphous blob without its algal symbiont. In the right test tube, the algal symbiont (named Trebouxia erici) has grown into a mass of bright green cells. Only when these two symbionts form the "marriage" known as lichen is the unique structure of "British soldiers" formed. In true synergistic fashion, the lichen is truly more than the sum of its parts. For example, the podetium is a unique lichen structure that is not found in the algae or fungi. [Cultures courtesy of J.L. Platt, CSUSM, San Marcos, California.]

Gender verification in the Olympic Games now employs sophisticated DNA testing rather than counting Barr bodies within the nuclei of cells. The test is designed to detect the presence of the SRY gene (sex region Y chromosome), a region of DNA on the short arm of the Y chromosome responsible for masculinization of the fetus. Cells from the buccal mucosa (squamous epithelial cells), often called "cheek cells" in general biology classes, are obtained by gently scraping the inside of the mouth with a toothpick. The DNA in the nuclei of these cells is amplified using the PCR technique (polymerase chain reaction). If present, the SRY gene will show up as a unique banding pattern by electrophoresis on agar gels.


4. Automated DNA Sequencer

In addition to DNA fingerprinting based on banding patterns from gel electrophoresis, scientists can also determine the exact sequence of bases (adenine, thymine, guanine and cytosine) in a DNA fragment or a complete gene. An instrument called an automated DNA sequencer analyzes the DNA sample and produces a printout with peaks and valleys representing all the four nucleotides (A, T, C and G). Special fluorescent nucleotides amplified with PCR produce color-coded printouts of the four bases. Modified nucleotides used in the PCR replication contain an attached molecule that fluoresces a particular color when it passes through a laser beam. Each DNA fragment (band) extracted through gel electrophoresis can be sequenced to show the exact order of bases. Entire genes are also sequenced, including DNA from chloroplasts, mitochondria, introns, and the genes that translate for large and small subunits of ribosomes.

Left: A DNA sequencer at California State University, San Bernardino. Right: Door of sequencer is open to show a gel plate inside.

Printout from a DNA sequencer showing the peaks and valleys of a portion of a sequenced gene that correspond to the color-coded bases adenine A, thymine T, guanine G and cytosine C. In this particular section of 34 bases, there are 434 = 2.951479 X 1020 or about 295 quintillion different possible sequences. In the San Diego trial of David Westerfield, the probability of a blood sample in his motor home matching the murder victim's DNA was 25 quadrillion to one.

DNA sequencing is a valuable tool in taxonomic studies of species within families and the phylogenetic relationships of larger categories of animals and plants. One of the most interesting studies of human genes has resulted in a theory that traces the mitochondrial DNA of humans to an ancestral woman who lived in Africa about 100,000 years ago. Since mitochondria are only passed on through the egg, the genes are relatively stable from generation to generation, compared with nuclear DNA which may be altered during meiosis and sexual reproduction. Chromosomal genes are recombined during crossing over, and reshuffled during random assortment of the chromosomes and random combination of the gametes.


5. Amplification Of DNA (Genes) Using PCR

All all of these remarkable methods of DNA analysis would be impossible without the ability to amplify DNA with the polymerase chain reaction. PCR is an extremely valuable technique in forensic criminology involving rape, murder and disputed parentage. DNA can be identified from small samples of blood, saliva, skin, hair follicles and semen. In fact, the acronym PCR became well-known during the O.J. Simpson trial. When amplifying genes using PCR, it is imperative that the sample not be contaminated with any foreign DNA, otherwise the foreign genes may be inadvertently amplified. For example, in a research paper the genes of a spruce tree were sequenced, only to find out later that the actual DNA came from an internal parasitic fungus that was living within the spruce sample!


6. Extraction Of DNA From Tissue Sample

In order to amplify a gene using PCR, the DNA from an organism must be extracted and placed in a test tube. There are several "cookbook method" procedures for extracting nuclear DNA from the nucleus and nucleolus, and cytoplasmic DNA from cellular organelles, including the chloroplast and mitochondria. Total genomic DNA includes the nucleus and cytoplasmic organelles. The following procedure was used to isolate genomic DNA from a duckweed (Lemna minuta). Although members of the duckweed family (Lemnaceae) are commonly polyploid, they still have one genome composed of multiple sets of chromosomes.

Extraction Of Genomic DNA From Duckweeds

 1. Place duckweeds in mortar with liquid nitrogen.
 2. Grind with pestle into a greenish powder.
 3. Add CTAB buffer (cetrimonium bromide) to maintain pH.
 4. Place in microcentrifuge tubes.
 5. Mix with vortexer.
 6. Incubate in 60o C water bath for 30-60 minutes.
 7. Add chloroform isoamylalcohol.
 8. Invert and mix.
 9. Centrifuge at 7,000 rpm.
10. Transfer upper aqueous phase to new tubes with micropipetter.
       [Lower phase contains proteins, phenolics, carbohydrates, etc.]
11. Add chloroform isoamylalcohol again.
12. Invert and mix again.
13. Centrifuge again.
14. Transfer aqueous phase to a new tube.
15. Add equal volume of isopropyl alcohol.
16. DNA precipitates out at room temperature (20o C).
17. Centrifuge at 10,000 rpm; DNA shows up as white pellet.

DNA can easily be extracted from dried split peas (or other vegetables) and a few ordinary household chemicals, including liquid detergent, meat tenderizer and rubbing alcohol (isopropyl alcohol). The procedure is illustrated at the web site of the Genetic Science Learning Center, University Of Utah:

  Extracting DNA From Plant & Animal Tissue  

Genomic DNA can be extracted from green split peas using a few ordinary household chemicals: 1. Juice Strainer, 2. Measuring Cup, 3. Test Tubes (and Test Tube Holder), 4. 50 ml beaker, 5. Tablespoon, 6. Liquid Detergent, 7. Meat Tenderizer, 8. Rubbing (Isopropyl) Alcohol, 9. Green Split Peas, and 10. Wooden Skewer (Stirring Rod).

A thick, pea-cell soup is made by grinding up 100 ml of dried split peas in a blender with 200 ml water, and then filtering through a fine-mesh strainer into a measuring cup. Two tablespoons of liquid detergent are added and the soup is allowed to sit for 10 minutes. Next the soup is placed in test tubes (1/3 full) or small glass containers. There is sufficient pea soup to fill a dozen or more small test tubes up to 1/3 full. Then a pinch of meat tenderizer containing papain or bromelain enzymes is added to each test tube and the mixture is gently (briefly) stirred with a slender rod such as a wooden skewer. Finally, rubbing alcohol (70-90% isopropyl alcohol) is slowly pored into each test tube (2/3 full) so that it forms a layer on top of the pea mixture. DNA rises into the alcohol layer like a cottony mass of threads and can be rolled onto a wooden stick or stirring rod. By adding isopropanol (which is infinitely soluble in the aqueous layer but not the DNA), the resultant solution forces the DNA out of solution as a solid. I.e. when the concentration of alcohol/water solution is such that the DNA is no longer soluble, the DNA precipitates out of solution. If you don't see any DNA, let the test tube sit for 15 minutes to an hour. A cottony mass should be visible in the alcohol layer, just above the thick pea soup layer. This genomic DNA comes from all the cells of the ground up peas. Unless it is cut by restriction enzymes into sections (RFLPs), it is much too long and stringy to migrate through the pores of agarose gel during electrophoresis.

The white cottony mass is genomic DNA suspended in the isopropyl alcohol phase. The DNA was extracted from cells of the ground-up green peas. It is very delicate and falls apart readily when handled. The green phase is a thick, opaque solution of ground split peas and liquid detergent.

An interesting fact about enzymes is that Jello® is not recommended with the following fresh or frozen fruits and roots: pineapple (Bromeliaceae: Ananas comosus), papaya (Caricaceae: Carica papaya), figs (Moraceae: Ficus carica), guava (Myrtaceae: Psidium guajava), kiwi (Actinidiaceae: Actinidia chinensis), and ginger root (Zingiberaceae: Zingiber officinale). All of these plants contain proteolytic (protein digesting) enzymes which prevent the gelatin from setting (changing into a gel state) as it cools. Some of these protease enzymes have been used medicinally and as meat tenderizers, such as ficin from figs (Ficus), papain from papaya (Carica), and bromelain from pineapples (Ananas). Try adding some pineapple juice to milk. The milk protein begins to coagulate and degrade as it reacts with the bromelain. Pineapple juice will also remove the gelatin-emulsion surface on black & white photographic film. [The emulsion surface contains light sensitive silver halides in a gelatin that is rinsed away during processing. The silver that remains on the film emulsion reveals the negative image from which the photographic print is created.] In French Polynesia, the ficin-rich sap from a native banyan fig is used to kill parasitic worms and to treat worts and skin cancers. Ficin also breaks down the female pollinator wasp inside wasp-pollinated Calimyrna figs grown in California's Central Valley. When you eat one of these delicious figs, you won't find the wasp inside that was responsible for the seed formation and superior nutty flavor.

See Candies Made With Gelatin
  Calimyrna Fig & Its Pollinator Wasp  


PCR Technique: Step By Step

7. DNA Ladder "Unzips" Into Two Separate Strands

DNA polymerase and a mixture of all four nucleotides are added to a test tube containing the extracted DNA sample. When the double-stranded parental (template) DNA is heated to 95 degrees Celsius, the individual strands unwind and separate from each other. The objective is to replicate the section of each strand containing the target gene using the enzyme DNA polymerase. Each single parental strand of DNA has the remarkable property of rebuilding the missing complementary strand as nucleotides attach in the 5 prime (5') to 3 prime (3') direction. Each newly-formed complementary strand (one for each parental strand) is called a "daughter strand."

When the double-stranded, parental DNA molecule (DNA ladder) is heated to 95o C, the two individual strands separate from each other. DNA polymerase facilitates the attachment of the complementary nucleotides to rebuild each strand, resulting in two double-stranded molecules. P = phosphate, D = deoxyribose, A = adenine, T = thymine, G = guanine, and C = cytosine. The extended phosphate "tail" represents the 5' position of each strand.

When the double-stranded, parental DNA molecule (DNA ladder) is heated to 95o C, the two individual strands separate from each other. DNA polymerase facilitates the attachment of the complementary nucleotides to rebuild each strand, resulting in two double-stranded molecules. The pink section represents the actual target gene that will be replicated.


8. Primer Attaches To One End Of DNA Strand

In order for DNA polymerase to find the start of a specific target gene in each section of DNA, a short segment of DNA called a primer must be attached (annealed) to each "mother" DNA strand upstream (toward 3' end) from each gene. The primer does not overlap the target gene, because it is complementary to the base sequence that appears just before the gene on the mother strand of DNA. The complementary "daughter" strand is produced in the 5' to 3' direction. Primers contain about 20 bases and they have been synthesized for many of the genes that are commonly amplified using the PCR technique. They may be purchased from biotechnology supply companies. The primer for a specific gene is added to the mixture of single-stranded DNA after it has cooled down to 52-54o C (126-129o F).

Short sections (oligonucleotides) called primers attach upstream from each gene (toward 3' end of parental "mother" strand). Now DNA polymerase can recognize the start of the gene and rebuild the complementary strand in the 5' to 3' direction.

As the double-stranded, parental (template) DNA ladder unzips and nucleotides attach to each of the two single parental strands, something very interesting happens. One daughter strand, called the "leading strand," forms continuously as nucleotides attach in the 5' to 3' direction. But in the other daughter strand, called the "lagging strand," the nucleotides attach in discontinuous sections. These sections are called Okazaki fragments, named after the Japanese scientist Reiji Okazaki who discovered them. Since the lagging strand is complementary to the leading strand, its 3' end is opposite the leading strand's 5' end, and vice versa. The only way this strand can lengthen in the 5' to 3' direction as the parental DNA molecule unzips, is is for it to grow in sections or fragments. This remarkable discovery is shown in the following illustration.

When the parental (template) DNA strands replicate, the daughter strands are synthesized in two different ways. The leading strand is formed continuously as single nucleotides attach one-by-one in a 5' to 3' direction. The lagging strand is formed discontinuously as preformed sections of nucleotides (called Okazaki fragments) attach in a 5' to 3' direction.


9. Telomeres: A Major Molecular Fix To The End Replication Problem

The structure and function of DNA are certainly two of the most significant discoveries that have revolutionized the science of biology. Even though DNA appears to be a perfect storage molecule for genetic information, it has a serious replication problem. Chromosomes of eukaryotic cells are composed of linear DNA. In order for cell division to take place, the DNA molecule must replicate. In other words, the single chromosome must become a doubled chromosome composed of two chromatids. The problem is that each time DNA replicates the new molecules get slightly shorter. After a number of consecutive divisions, this degradation could result is serious gene loss at the ends of the chromosomes. Both Alexey Olovnikov and James Watson independently described this phenomenon called "end replication problem" in the early 1970s. In fact, Olovnikov's "A Theory of Marginotomy" predicted that the loss of terminal sequences resulting from end replication problem would lead to senescence (Olovnikov, 1973). [James Watson and Francis Crick discovered the structure of DNA in 1953 and received the Nobel Prize in Medicine in 1962.]

To cope with the devastating end problem replication problem, eukaryotic cells have evolved protective "caps" on the ends of chromosomes called telomeres. For their discovery of how chromosomes are protected by telomeres and the enzyme telomerase, Elizabeth Blackburn, Jack Szostak and Carol Greider were awarded the Nobel Prize in Medicine in 2009. With their ingenious genetic research and meticulous biochemical studies, they not only solved a fundamental problem in biology but also opened a new field of research and initiated the development of potential therapies against the aging process and cancer. It should be noted here that more than 60 years earlier, Barbara McClintock was studying telomeres in corn. In the early 1940s she turned her attention to the study of transposable elements (transposons) in corn, another remarkable genetic phenomenon with important medical implications in people. For her lifelong research on transposons, she received the Nobel Prize in Medicine in 1983.

Cell Division (Mitosis) In Eukaryotic Cells
Major Chemical Compounds Of Life (Part 1)
DNA and Polymerase Chain Reaction (PCR)
 Transposons: Transposable "Jumping" Genes 

Telomeres are repetitive strands of DNA (sequences of repetitive bases) at the terminal ends of linear chromosomes. They play an essential role in maintaining the integrity of the chromosome by protecting it from degradation and from end-to-end fusion with other chromosomes. Telomeres are essentially protective "end caps" of non-coding DNA at the extreme ends of chromosomes. Telomeres have been metaphorically compared with the tips of shoelaces that keep the laces from unraveling. Each time a cell divides, the telomeres lose a small amount of DNA. Eventually, when all of the telomere DNA is gone, the cell can no longer divide and dies. End replication problem is not an issue in prokaryotic cells because they have circular DNA molecules without ends.

The number of times a population of normal cells can divide is called the Hayflick limit, named after its discoverer Leonard Hayflick. In 1961, Hayflick demonstrated that normal human fetal cells in a culture divide between 40 and 60 times. It is now clear that cell division occurs until the telomeres reach a critical length. An estimated length for human telomeres ranges from 8,000 base pairs at birth to 3,000 as people age, and as low as 1,500 in elderly people. Starting with 8,000 base pairs, a loss of 100 to 200 with each division would completely erode away the telomeres in 40 to 80 divisions.

Prerequisites For DNA Polymerase:

1.  When DNA Unzips, DNA Polymerase Must Attach To 3' End of Mother Strand.
2.  It Must Add Nucleotides (Synthesize Daughter Strand) In The 5' to 3' Direction.
3.  An RNA Primer Must Attach First To Give DNA Polymerase A Place To Start.

Chromosome duplication starts with the unzipping of the double stranded DNA into two strands (mother strand #1 & mother strand #2). These complementary mother strands serve as templates to build two DNA molecules. An RNA primer attaches to the 3' end of mother strand #1, thus giving DNA polymerase a place to start. The primer attaches just before the initial attachment of DNA polymerase. DNA polymerase moves in the 3' to 5' direction along mother strand #1, adding nucleotides to form a continuous complementary daughter strand of DNA the entire length of the mother strand #1 template. This complementary strand is called the "leading strand" and it is synthesized in the 5' to 3' direction. [5' and 3' refer to specific carbon atoms of deoxyribose sugar in DNA building blocks called nucleotides.] When 5' and 3' directions are mentioned, it is important to specify whether you are referring to the mother strand or the complementary daughter strand.

As the original mother DNA unzips, DNA polymerase cannot attach to the top of mother strand #2 at the 5' position (top right in following diagram). Even if it could attach to the top of mother strand #2 at the 5' position, it could not move down the mother strand and synthesize a daughter strand in the 3' to 5' direction. Therefore, DNA polymerase attaches farther down on mother strand #2 and produces a series of DNA sections in the 5' to 3' direction. These sections are named "Okazaki fragments" after the Japanese scientist Reiji Okazaki who discovered them. The sections collectively form a daughter strand called the "lagging strand" to the top of mother strand #2. This is nicely explained by R. Ohki, T. Tsurimoto and F. Ishikawa (Molecular and Cellular Biology Vol. 21, 2001). Short RNA primers must attach ahead of each DNA section in order to form a starting point for DNA polymerase.

There is a problem at the 3' end of mother strand #2. When the last RNA primer reaches this end, there is no more DNA template for it to keep ahead of DNA polymerase. The last primer attaches to the 3' end, but DNA polymerase cannot add the last section of the lagging strand, leaving a gap where the primer was attached. Therefore, the 5' end of each newly synthesized lagging strand is cut short. About 100 base pairs are shaved off with each round of replication, thus shortening the telomere. In the following diagram, mother strand #2 has a gap at the 5' end of the newly formed lagging strand.

The following animated gifs show replication of DNA in six consecutive divisions without any shortening, compared with the end replication problem on lagging strand and the gradual shortening of DNA.

  See Animation Of DNA Replication  

Telomeres can be restored by the enzyme telomerase. This enzyme lengthens telomeres in germ cells (cells that produce eggs and sperm), thus restoring telomeres to their maximum length in the zygote. It is also present in other cells that must continually divide, including bone marrow stem cells that produce large numbers of generations of red blood cells necessary to sustain life, the epithelium of skin, and cells lining the intestine. Telomerase is generally not active in normal somatic cells. This enzyme adds noncoding DNA sequence repeats TTAGGG in vertebrates to the 3' end of DNA strands in the telomere region of eukaryotic chromosomes. The presence of active telomerase in cancer cells may be useful in the diagnosis and treatment of some cancers with telomerase inhibitors.

The following paragraph comes from Science and Technology (9 November 2007): Sharks have telomerase in all of their cells. Their telomeres don't shorten and sharks do not have a genetically programmed life span like humans. In fact, sharks keep growing throughout their life. The limit to their life span is the fact that they must keep moving in order to circulate air through their gills for the uptake of oxygen. Sharks are exceptionally genetically stable, having changed very little in hundreds of millions of years. In addition, sharks rarely get cancer.

Telomeres and telomerase also occur in plant cells. Plant telomere biology is summarized by T.D. McKnight and D.E. Shippen in The Plant Cell Vol. 16: 794-803 (2004). In most flowering plants, telomeres consists of the DNA base repeats TTTAGGG. Like the somatic cells of animals, there is little or no active telomerase in vegetative tissue, although it is reactivated during flowering, probably to ensure that gametes and embryos inherit telomeres restored to their maximum length. Like cancer cells in in animals, telomerase is fully functional in cells of plant tissue cultures, as might be expected for cells with an unlimited capacity for proliferation. The monocot order Asparagales that contains about 27,000 species (roughly10 percent of all angiosperms) has 6-base repeats of TTAGGG, the same sequence found in mammalian telomeres. This order includes many familiar plant families, such as orchids, iris, amaryllis, agave, onion and asparagus. Since plants and mammals evolved into multicellular organisms along completely separate pathways, this appears to be yet another example of parallel evolution (homoplasy).

Telomeres do not prevent the shortening of DNA, they just postpone the erosion process. The telomere shortening mechanism normally limits cells to a fixed number of divisions. Eventually, when all of the telomere is gone, the cell can no longer divide, thus terminating the cell cycle. Most cancer's are the result of "immortal" cells which have evaded programmed cellular death due to erosion of telomeres. Chromosomes of malignant cells usually do not lose their telomeres, thus resulting in uncontrolled cell division. Animal studies suggest that telomere length may be related to the aging process on the cellular level and the life span of animals. There are even studies suggesting that regular exercise and stress reduction may help to minimize telomere erosion. In fact, a study published in the May 3, 2005 issue of the American Heart Association journal Circulation found that weight gain and increased insulin resistance were correlated with greater telomere shortening over time.

Diagram of Chromosome Doublet Showing Centromere
 The Structure Of Cell Membranes & Insulin Resistance 

It is interesting to speculate on the origin of telomeres. If another version of DNA polymerase existed that attached to the 5' end of mother strand #2 and added nucleotides in the 3' to 5' direction, then theoretically a continuous strand could be synthesized to the end of the mother strand template without the end replication problem. This theoretical version has never been found and therefore telomeres are essential to prevent the gradual shortening of DNA and erosion of genes. Why is there only one form of DNA polymerase that synthesizes daughter strands in the 5' to 3' direction? This is like asking why living systems only have L-form (left handed) amino acids and D-form (right handed) sugars. Did the evolution of telomeres solve a replication problem inherent in the original DNA, or were telomeres present in the original DNA of the first eukaryotic cells?

Evolutionary Significance of End Problem Replication & Telomeres

When I first wrote this section about end replication problem, I concluded that it was a defect in DNA that literally shortened the life of a cell by limiting the number of divisions. Telomeres serve as mitotic time clocks that prolong life by a certain number of consecutive erosions. However, there is another side to this story where limiting the life span of organisms could actually be beneficial. In a rapidly changing environment, survival of a species depends on genetic variability through DNA mutations and the ability to pass these genes on to future generations. A species with exceedingly long generation times may not be able to compete because adaptive mutations can't keep up with environmental changes; however, longer generation spans could also slow population growth as long as fecundity (number of offspring per female) remains constant. To an individual, immortality may seem good; however, this may not be good for the species. This logic is mentioned in Star Trek 2: "The Wrath of Khan" when Spock said: "The good of the many outweighs the good of the few, or the one." Actually, this logic is mentioned two thousand years earlier in John 11:49-50. Of course, one caveat to the benefit of end replication loss is the shark, which apparently has active telomerase in all of its cells and telomeres lengths that don't decline significantly with age. Sharks (class Chondrichthyes) are a very successful group and they have been around for more than 200 million years. In fact, some species have age estimations of 100 years or more. Undoubtedly, environmental changes in the ocean have not been as rampant as on land.

 Principles Of Population Growth 


10. Single DNA Strands Replicate Into Doubled Strands

The DNA mixture is heated to 72o C (162o F) and DNA polymerase recognizes the primer annealed to each strand and proceeds to synthesize the complementary strand all the way down the gene. Nucleotides attach along the gene from all the adenines, thymines, cytosines and guanines that are already in the mixture. Now the mixture contains two identical copies of the gene (two complete DNA ladders). DNA polymerase from the bacterium Thermus aquaticus (called TAQ polymerase) is used for the reaction because it is immune to the high temperatures. Unlike most protein enzymes that are destroyed at temperatures above 40o C (104o F), DNA polymerase from Thermus aquaticus can survive the 72o C of the reaction. In fact, this bacterium normally lives in hot springs and can survive temperatures approaching the boiling point of water.


Bacteria Of Boiling Hot Springs In Yellowstone National Park

Boiling hot springs in Yellowstone National Park are colored by colonies of thermophilic cyanobacteria, eubacteria and archaebacteria. Orange-colored cyanobacteria generally occur in water that has cooled below 73o C (163o F). The green chlorophylls in these photosynthetic bacteria are masked by orange carotenoid pigments. Like the bright red halobacteria of salt lakes, carotenoids protect the delicate cells from intense solar radiation, especially during the summer months. Warmer, whitish areas of the ponds contain stringy masses of nonphotosynthetic eubacteria. Thermus aquaticus survives in temperatures too high for photosynthetic bacteria, up to 80o C (176o F). Thermus aquaticus is heterotrophic and survives on minute amounts of organic matter in the water. TAQ polymerase used in the amplification of DNA using the polymerase chain reaction (PCR) was originally isolated from a colony of T. aquaticus collected in a hot spring at Yellowstone National Park.

A boiling hot springs in Yellowstone National Park. The orange-red coloration is caused by dense colonies of photosynthetic cyanobacteria.

Archaebacteria thrive in boiling water at Yellowstone National Park, at temperatures of 92o C (198o F). These bacteria also thrive near steam vents at the bottom of the ocean at temperatures exceeding 115o C (239o F). Scientists from throughout the world are studying the amazing bacteria flora at Yellowstone National Park. This is one of the best places on earth to study these organisms in their natural protected habitats. In other parts of the world, similar hot springs have been destoyed for the production of geothermal energy.

Boiling hot springs in Yellowstone National Park. The orange-red coloration is caused by thriving colonies of photosynthetic cyanobacteria. Stringy masses of nonphotosynthetic eubacteria occur in the whitish areas of warmer water.

Acid hot springs in Yellowstone National Park with a pH of below 4.0 support the eukaryotic alga Cyanidium caldarum. This remarkable photosynthetic alga can even survive in a pH of zero! Some acidophilic hot springs bacteria utilize the oxidation of sulfur and iron for the synthesis of ATP. Alkaline hot springs support colonies of bacteria that utilize hydrogen sulfide for their energy source.

  Major Divisions Of Bacteria Within The Kingdom Monera   

Life as we know it may have first arisen more than three billion years ago in a high temperature environment of boiling water. Thermophilic bacteria in hot springs of Yellowstone National Park may be relict populations of the first life on earth. In fact, these thermophilic bacteria may be the ancestors of all other life forms, including humans!


11. Two DNA Ladders "Unzip" Into Four Separate Strands

Now the mixture is once again heated to 95o C and the double-stranded DNA molecules containing the target genes separate into single strands. But now there are four single strands from two double-stranded genes. The mixture is once again cooled to 52-54o C and the primers anneal to the strands at start positions before each gene. DNA polymerase once again catalyzes the rebuilding of each single strand into four complete double-stranded genes. PCR is called polymerase chain reaction because the reaction occurs repeatedly in cycles as duplicate copies of genes are produced exponentially. After only 40 cycles there would be 1.0995116 X 1012 or more than one trillion copies of the original gene!

The two double-stranded DNA molecules (DNA ladders) separate into four strands. DNA polymerase will rebuild the complementary strand for each ladder, resulting in four double-stranded DNA molecules. Note: This illustration does not show the end replication problem where DNA shortens during repetitive divisions.

  See Animation Of DNA Replication  


12. Using Lice DNA To Date The First Clothing Worn By People

One of the most novel uses for DNA sequencing is the determination of when humans first began wearing clothing. According to Mark Stoneking and his colleagues at the Max Planck Institiute for Evolutionary Anthropology in Leipzig, Germany, we started wearing clothing about 70,000 years ago. This date is based on genes of human sucking lice. It correlates with the approximate time when the body louse evolved from the human head louse and corresponds to the time when the body louse's habitat (clothing) became widespread. This is also the time when Homo sapiens sapiens began moving out of Africa into cooler regions of Europe.


Human head louse
Sucking lice belong to the wingless, parasitic insect order Anoplura. Human sucking lice include body lice, crab lice and head lice (Pediculus humanus). Anoplurans use a set of long hypodermic-like stylets to pierce the skin and withdraw blood. After ingesting blood their body becomes swollen and shows a dark clot of blood in their abdomen. There are two forms of human sucking lice, the head louse (P. humanus capitis) and the body louse (P. humanus humanus). The head louse infests the hair of the scalp and the body louse lives in clothing near the body surface. Human lice are also known as "cooties" and their eggs attached to hairs are called "nits." Human lice cause local itching, but the discomfort is minor compared with the misery of the bacterium they can transmit called Rickettsia prowazeki. This minute bacterium causes "Epidemic Typhus," a serious disease that has devastated populations in medieval Europe.

Stoneking and his colleagues Ralf Kittler and Manfred Kayser compared mitochondrial DNA sequences from head and body lice. The greater the difference in sequences between the two forms of lice, the older their evolutionary split. Human lice from Africa are more genetically diverse than lice from other parts of the world, indicating that the species originated in Africa. Head lice are more diverse than body lice, showing that they are the older group. By comparing the mitochondrial DNA of body lice to chimpanzee lice, Stoneking's team was able to approximate the origin of body lice to around 70,000 years ago. This date correlates well with the growing evidence that modern humans evolved in Africa and migrated northward around 100,000 years ago.

Stoneking is also studying human crab lice (Pthirus pubus) which typically inhabit pubic hair. Human pubic lice are more closely related to gorilla lice than to head lice. Since this sucking louse only inhabits hairy places on the body, it might shed some light on when humans lost their heavy body hair. Crab lice are typically transferred from person to person through sexual intercourse, although they may also be picked up from infested linen, clothing and other sources.

For More Information About The Origin Of Body Lice:

  • Kittler, R., M. Kayser and M. Stoneking. 2003. "Molecular Evolution of Pediculus humanus and the Origin of Clothing." Current Biology 13: 1414 - 1417.

Return To The Biology 100 DNA Lab
Return To The Biology 100 Home Page
Return To WAYNE'S WORD Home Page
Return To NOTEWORTHY PLANTS Page
Go To Biology GEE WHIZ TRIVIA Page
Go To The LEMNACEAE ON-LINE Page